University of Valencia logo Logo Central Service for Experimental Research (SCSIE) Logo del portal

Process for SNP analysis:

1. Previous study of the sequence to analyse and execution of the budget.

The client must email the name (as RS code) and/or the sequence of each one of the SNP to be analysed. An example of a sequence would be:

RS2306283:

  • GTACTCTGGTAATTTGGGGAAGATAATGGTGCAAATAAAGGGGAATATTTCTCTGTAT
    TTCTAGGAAAAGTGAAAATATTCAGTAGATAAGCAAAATGTTTAATTCAGTGATGTTC
    TTACAGTTACAGGTATTCTAAAGAAACTAATATC[A/G]ATTCATCAGAAAATTCAAC
    ATCGACCTTATCCACTTGTTTAATTAATCAAATTTTATCACTCAATAGAGCATCACCT
    GAGATAGTGGGAAAAGGTAAGAATTAATATTGACAGTAAAAAGTCTTCTAAAATGTAT
    ACATTTAATTACATC

Where the SNP is closed with brackets and each possible genotype separated by a vertical bars. In case of a point mutation will be identified with the “-“sign.

  • GTAGACGCT[C/-]GTACGACT

An insertion will be indicated by:

  • ATGGATG[G/GTATGT]GTACGCGT

In any case we need a minimum of 100pb before and after the brackets that mark the SNP. This sequence will be analysed for designing amplicons that allow analysing the desired SNP using the software “MassarrayAssayDesign" by SEQUENOM. The client will be sent the results of this initial analysis and will be agreed which SNPs are chosen for the analysis and how these will be grouped. The budget will be elaborated at this moment taking into account the number of SNP and of DNA samples for analysing. Once the agreement is established, the client will sign the budget and he will be charged with the 50% of the corresponding invoice, and the remaining 50% will be charged once the work is finished.

2. Sending of DNA samples

The samples will be sent in 96 well-plates (for example, AppliedBiosystems PN 4306737), covered with cap strips (such as Applied Biosystems PN4323032) or adhesive films. For a typical project we will need about 500 ng at a total concentration of 20ng/ul minimum (DNA quantified by the user through fluorimetric technique “Picogreen”). However, we can try to work with lower concentrations. The DNA sent will be dissolved in water.
The client should send an attached Exceel sheet (Template plates 96.xls or Template plates 384.xls) filling it out indicating the position of each sample of DNA in the sample. The codes of identification of samples should not contain strange characters like spaces, “/”, “-“, etc.
Procedure for quantifying the expression of mRNAs.
 

Procedure for the quantitative analysis of the DNA methylation degree

This system can analyse multiple CpGs islands of until 600 base pairs in length in a single reaction, with a precision in the degree of change of methylation of up to 5%. The amount of DNA needed for reaction is minimum (5pg) and does not require a previous treatment.

1. Previous study of the sequence to analyse and execution of the budget

The user will email the sequence to analyse (usually the promoter of the gene in question and a 1000pb upstream). This sequence will be analysed for designing amplicons that allow analysing the maximum number of CpGs using the programme "EpiDesigner Beta" by SEQUENOM. We will send the result of this initial analysis and will be agreed which amplicons are chosen for the analysis. The budget will be elaborated, at this moment, taking into account the number of aplicons and DNA samples for analysing. Once the agreement is established, the client will sign the budget and he will be charged with the 50% of the corresponding invoice, and the remaining 50% will be charged once the work is finished.

2. Sending of DNA samples

The samples will be sent in 96 well-plates (for example, AppliedBiosystems PN 4306737) covered with cap strips (such as Applied Biosystems PN4323032) or adhesive films. . For a typical project we will need about 2-3 ug of a total concentration of 50ng/ul minimum (DNA quantified by the user through fluorimetric technique “Picogreen”). However, we can try to work with lower concentrations. The DNA sent will be dissolved in water.
The client should send an attached Exceel sheet (Template plates 96.xls or Template plates 384.xls) filling it out indicating the position of each sample of DNA in the sample. The codes of identification of samples should not contain strange characters like spaces, “/”, “-“, etc.

Procedure for quantifying the expression of mRNAs.The client must email the name (as Ensembl code) of each one of the mRNAs to analyse. An example could be:

1. Previous study of the sequence to analyse and execution of the budget

The client must email the name (as Ensembl code) of each one of the mRNAs to analyse. An example could be:

This code will be used for designing oligonucletotides and competitors that allow the analysis of the desired transcripts using the programme "Massarray Assay Design" by SEQUENOM. We will send to the clients the result of this initial analysis and will be agreed which transcripts are chosen for the analysis and how they will be grouped. The budget will be elaborated, at this moment, taking into account, the number of mRNAs and of ARN samples for analysing. Once the agreement is established, the client will sign the budget and he will be charged with the 50% of the corresponding invoice, and the remaining 50% will be charged once the work is finished.

2. Sending of DNA samples

The samples should be sent in eppendorf tubes. For a typical project we recommend you to send 1-2ug of RNA to a concentration of 50ng/ul minimum (RNA quantified by the user through fluorimetric technique “Picogreen” or similar). However we can try to work with lower concentrations. The RNA sent will be dissolve in water. 

The codes of identification of samples should not contain strange characters like spaces, “/”, “-“, etc.